kimA [2020-06-30 14:31:42]

high-affinity potassium transporter (uptake)

Locus: BSU_04320

Isoelectric point: 9.93

Molecular weight: 66.60 kDa

Protein length: 607 aa

Gene length: 1824 bp

Function: potassium uptake

Product: high-affinity K⁺/H⁺ symporter

Essential: no

Synonyms: ydaO

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Metal ion transporter
• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Potassium uptake/ export
• Information processing → Targets of second messengers → Targets of c-di-AMP
• Groups of genes → Membrane proteins

Gene

Coordinates: 486,432 488,255

Phenotypes of a mutant

• a kimA ktrA ktrB mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source PubMed

The protein

Catalyzed reaction/ biological activity

• K⁺/H⁺ symport PubMed

Protein family

• KUP family (single member) PubMed
• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Kinetic information

• K_M: 215 µM PubMed
• V_max 245 nmol min⁻¹ mg⁻¹ PubMed

Domains

• 12 trans-membrane helices at the N-terminus PubMed
• C-terminal cytoplasmic domain PubMed

Effectors of protein activity

• activity is inhibited upon binding of c-di-AMP PubMed
• in the Listeria monocytogenes protein, c-di-AMP binds to the C-terminal cytoplasmic domain of KimA PubMed

Structure

• 6S3K PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: kimA
  Description: PubMed

  Regulatory mechanism

  • ydaO riboswitch: termination/antitermination, expression is switched off upon binding of c-di-AMP (formed at high potassium concentration) PubMed, in ydaO riboswitch

  Regulation

  • expressed at low potassium concentration (ydaO riboswitch) PubMed

Biological materials

Mutant

• MGNA-C090 (kimA::erm), available at the NBRP B. subtilis, Japan
• 1A688 (kimA::erm), available at BGSC
• GP93 (ΔkimA::cat), available in Jörg Stülke's lab PubMed
• JH642 and its derivatives: natural deletion of the 18 kb ydzA-mntH region encompassing the genes ydzA-topB-ydaJ-ydaK-ydaL-ydaM-ydaN-kimA-mutT-ydaP-ydzK-mntH PubMed
• BKE04320 (ΔkimA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG
• BKK04320 (ΔkimA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG
• GP2720 (ΔkimA::spc), available in Jörg Stülke's lab
• GP2721 (ΔkimA::ermC), available in Jörg Stülke's lab
• GP2498 (ΔkimA::cat ktrA-ktrB::spc), available in Jörg Stülke's lab

Expression vectors

• pGP2913 (N-terminal His-tag, expression in E. coli, in pWH844), available in Jörg Stülke's lab PubMed

LacZ fusion

• BP144 (based on pAC5), available in Fabian Commichau' and Jörg Stülke's labs PubMed

FLAG-tag construct

• GP2405 ydaO-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage
• Inga Hänelt, Frankfurt, Germany Homepage

References

Reviews

Loading

Original publications

Loading